Estudo da atividade da enzima profenoloxidase de lagartas de Diatraea saccharalis desafiadas por microrganismos



Baixar 26.57 Kb.
Encontro14.08.2018
Tamanho26.57 Kb.



Estudo da atividade da enzima profenoloxidase de lagartas de Diatraea saccharalis desafiadas por microrganismos
Ana Paula Pivotto (PIBIC/Fundação Araucária/Unioeste), Luis Francisco Angeli Alves, Marina Kimiko Kadowaki, Rita de Cássia Garcia Simão, José Luis da Conceição Silva(Orientador), e-mail: jlcsilva@gmail.com
Universidade Estadual do Oeste do Paraná/Centro de Ciências Médicas e Farmacêuticas/Cascavel-PR
Grande área e área: Ciências Biológicas - Bioquímica
Palavras-chave: imunidade inata, atividade enzimática, hemolinfa.
Resumo
A lagarta Diatraea saccharalis, popularmente conhecida como broca-da-cana, é uma praga da cana-de-açúcar para qual existem estratégias eficientes de controle biológico, entretanto pouco é conhecido sobre o seu sistema imune inato. A enzima Profenoloxidase (PPO) faz parte do mecanismo humoral, presente na hemolinfa na forma de zimogênio (inativa), sendo ativada com a injúria e/ou invasão da hemocele por microrganismos. Esta enzima é conhecida em insetos da ordem Lepidoptera, todavia, permanece não caracterizada em D. saccharalis. O principal objetivo deste trabalho foi investigar a atividade da enzima PPO após a injúria séptica e caracterizar parcialmente o gene PPO. A dosagem espectrofotométrica da atividade enzimática foi realizada após a inoculação de Escherichia coli e foi comparada com a lagarta não desafiada. As análises mostraram que não houve alteração da atividade enzimática nos períodos iniciais após o desafio imune, ou seja, lagartas desafiadas por 180 min. não apresentaram diferença significativa em relação às lagartas controle. Sequencias gênicas da enzima PPO de outros Lepidópteros foram analisadas para a localização de regiões conservadas para síntese de iniciadores. Os oligonucleotídeos desenhados para o gene da enzima PPO amplificaram na reação em cadeia da polimerase (PCR) um fragmento de aproximadamente 450 pb, que após o sequenciamento apresentou homologia com enzimas do sistema imune de Lepidópteros, levando-nos a acreditar que obtivemos uma sequencia parcial para o gene de uma enzima do sistema imune que será futuramente sequenciado e caracterizado bioquimicamente.
Introdução
No início dos anos 80 surgiu uma nova área de investigação da imunidade inata com o relato dos primeiros peptídeos antimicrobianos em insetos (Steiner, 1981). Com o avanço neste campo, descobrimos que a resposta imune celular é mediada por hemócitos e a resposta humoral é efetivada por AMPs produzidos principalmente pelo corpo gorduroso (Lavine & Strand, 2002).

Em insetos modelo, como exemplo Drosophila melanogaster, são conhecidos os mecanismos moleculares da resposta imune inata celular e humoral (Hoffmann, 2003), como também ocorrem para alguns Lepidópteros, como é o caso de Bombyx mori (Liu et al., 2009).

Uma importante enzima que participa do sistema imune é denominada Profenoloxidase (PPO), presente na hemolinfa na forma de zimogênio, sendo ativada com a injúria e/ou invasão da hemocele por microrganismos. Geralmente, a enzima é ativada por uma cascata de clivagem proteolítica induzida após a presença de LPS, peptídeoglicanos e β-1,3 glucanos (Cerenius et. al., 2008). O substrato inicial é L-3,4-Diidroxifenilalanina e o produto final da cascata é a melanina. A cascata de melanização deve ser controlada porque a formação excessiva de quinonas e a inapropriada síntese de melanina, podendo ser deletéria para o hospedeiro (Gilbert, 2012). Esta enzima é conhecida em vários insetos da ordem Lepidoptera, entretanto, permanece não caracterizada em D. saccharalis, sendo desconhecida com relação à sua sequencia gênica, e não há relatos da atividade enzimática após a injúria com microrganismos. Encontramos apenas um estudo, relatando a atividade da enzima PPO em D. saccharalis, após a lagarta estar inoculada pelo parasitóide Cotesia flavipes (Lopes, 2008).

Os objetivos do trabalho foram: a) verificar a resposta imune de ativação da PPO mediante a inoculação por microrganismos; b) buscar sequencias de DNA da enzima PPO de Lepidópteros depositadas no banco de dados do NCBI (National Center for Biotechnology Information); c) conhecer as regiões conservadas da enzima para o desenho de oligonucleotídeos específicos para a amplificação parcial do gene de PPO em D. saccharalis.


Materiais e Métodos
O cultivo das lagartas foi realizado em câmara climatizada com as condições controladas de 28 ± 1 °C; 60 ± 10% UR; fotoperíodo 14h, no laboratório de Biotecnologia da Unioeste. A imunização ou desafio das lagartas foi realizado de acordo com a metodologia de Silva et al. 2010. No grupo desafiado, a hemolinfa foi coletada nos tempos de 3 horas após a inoculação (hpi) e 5 horas e 30 min. (hpi). O grupo não desafiado foi realizado o mesmo procedimento de coleta. A separação dos hemócitos e a recuperação da hemolinfa foi realizada por centrifugação em 4 ºC.

A atividade da enzima PPO foi determinada em espectrofotômetro (= 490 nm) de acordo com Lopes (2008), com algumas modificações. A extração de DNA genômico da lagarta foi realizada com o Kit Axyprep DNA Genômico Miniprep Multifunção® (Axygen) de acordo com o fabricante. As dosagens de DNA genômico, os géis de agarose e as reações de PCR com os primers direto 5'AATCCCCAGCTTTTCAACTAC3' e reverso 5’ATAGACGAGATGCCAATGCC3’ seguiram protocolos do laboratório de bioquímica e biologia molecular.


Resultados e Discussão
Aproximadamente 50 µL de hemolinfa foi coletado 3 hpi e 5 hpi após o desafio com E. coli para o mesmo grupo experimental. Após, a hemolinfa foi diluída mil vezes em tampão Tris-HCl pH 7,6 com L-dopa 5 mM e foi realizada a leitura no espectrofotômetro em 490 nm, por 1 hora em intervalos de 5 minutos.

Entretanto, ao que parece a enzima não mostrou um aumento em sua atividade com o tempo de inoculação quando desafiada por E. coli. Para comparação foram realizadas leituras de lagartas não desafiadas, livres de qualquer contaminação na dieta. Como observamos nos experimentos, as absorbâncias obtidas mostraram que a enzima PPO não teve modificação significativa de atividade na lagarta nativa, no tempo de 1 hora de leitura (0,470A) e na da lagarta desafiada (0,402A). Esse resultado sugere que em tempos inicias após o desafio, a enzima não está sendo ativada pela injúria séptica. Entretanto, observamos que existe uma tendência de diminuição na atividade da enzima nas lagartas desafiadas que é dependente do tempo de exposição aos microrganismos. Lopes (2008) mostrou que a resposta humoral na atividade de PPO em D. saccharalis desafiada pelo parasitóide Cotesia flavipes, é dependente do tempo, todavia as alterações foram observadas após o desenvolvimento imaturo do parasitóide, ou seja, no mínimo 1 dia após o desafio imune.

O PCR com o DNA genômico, mostrou a amplificação de duas bandas de visualizadas no gel de agarose 1,5% na raia 2 da figura 1. A banda de 450 pb indicada pela estrela amarela foi sequenciada. Após a comparação com sequencias depositadas no NCBI com a ferramenta Blast-n, a sequencia de D. saccharalis mostrou homologia com um fragmento de 126 pb do gene "latSPL2" com um e-value 6e-13 e 75% de identidade (94 pb/126 pb). Este gene codifica para uma serino-protease de Ostrinia latipennis. As serino-proteases são enzimas que catalisam a clivagem de zimogênios na hemolinfa, convertendo-os em suas formas ativas.

Figura 1. M = Marcador 100 pb Invitrogen; 1 gene ribossomal 18S e 2= PCR com os primes PPO.




Conclusões
Através dos resultados, pode-se concluir que a enzima profenoloxidase desempenha um papel importante para a defesa da lagarta Diatraea saccharalis, mostrando alta atividade enzimática, contudo sem diferença significativa nas lagartas desafiadas por microrganismos e não desafiadas em tempos iniciais de indução da resposta imune. Com os ensaios de PCR e sequenciamento de DNA verificamos a homologia do fragmento genômico sequenciado com uma serina-protease de Ostrinia latipennis, um Lepidóptero da família Crambidae, mostrando conservação de sequencias gênica dentro das famílias de Lepidópteros.
Agradecimentos
À UNIOESTE e Fundação Araucária pelo auxílio concedido.
Referências
Carvalho, C.V., Giannina, R. & Regina, A. (2010). Guia de práticas em biologia molecular. São Caetano do Sul: Yendis.
Cerenius, L., Lee, B.L. & Söderhäll, K. (2008) The proPO-system: pros and cons for its role in invertebrate immunity. Trends in Immunology 29, 263–271.
Gilbert, L.I. (2012). Insect molecular biology and biochemistry. Waltham: Academic press, Elsevier.
Hoffmann, J.A. (2003).The immune response of Drosophila. Nature 426, 33-38.
Lavine, M.D. & Strand, M.R. (2002). Insect hemocytes and their role in immunity. Insect Biochemistry and Molecular Biology 32, 1295–1309.
Liu, F., Ling, E. & Wu, S. (2009). Gene expression profiling during early response to injury and microbial challenges in the silkworm, Bombyx mori. Archives of Insect Biochemistry and Physiology 72, 16–33.
Lopes, C.S. (2008) Regulação do desenvolvimento e resposta imune de Lagartas de Diatraea saccharallis. Dissertação de Mestrado em Ciências (Entomologia), Escola Superior de Agricultura Luiz de Queiroz.
Steiner H., Hultmark, D., Engström, A., Bennich H. & Boman, H.G. (1981). Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature 292, 246-248.




: eventos -> eaicti -> eaictiAnais -> arquivos
arquivos -> Avaliação do efeito da clorexidina e do hipoclorito de sódio na cimentação adesiva de pinos – estudo in vitro
arquivos -> Análise clinicopatológica de tumores malignos de glândula salivar provenientes de uma casuística de Cascavel (PR) diagnosticados entre os anos de 2001 a 2015
arquivos -> Análise morfométrica dos tecidos gengivais de ratos castrados e com periodontite experimental
arquivos -> Eletrodo de hidroxiapatita para determinação de matéria orgânica
arquivos -> Aplicabilidade da acupuntura auricular no controle da dor, depressão e incapacidade em pacientes portadores de disfunção temporomandibular
arquivos -> Avaliação clínica comparativa entre duas técnicas cirúrgicas para recobrimento radicular em classes I e II de Miller
arquivos -> Análise do conhecimento a respeito da psiconeuroimunologia e do uso da abordagem holística pelos enfermeiros do município de Foz do Iguaçu-pr na prática diária
arquivos -> Estudo morfométrico do plexo submucoso do jejuno de ratos em modelo experimental de câncer tumor de Walker-256
arquivos -> Avaliação da compactação do solo em sistema semeadura direta submetido ao trafego de conjuntos de transbordos graneleiros
arquivos -> Cateter central de inserção periférica: análise do uso na unidade de tratamento intensivo neonatal do Hospital Universitário do Oeste do Paraná




©aneste.org 2017
enviar mensagem

    Página principal